yusV [2019-04-24 13:42:01]

ABC transporter for the siderophores Fe-enterobactin and Fe-bacillibactin, as well as for the siderophores schizokinen and arthrobactin (ATPase)

Locus: BSU32940

Isoelectric point: 5.32

Molecular weight: 30.34 kDa

Protein length: 275 aa

Gene length: 828 bp

Function: acquisition of iron

Product: ABC transporter for the siderophores Fe-enterobactin, Fe-bacillibactin, schizokinen and arthrobactin (ATPase)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of iron/ siderophores
• Cellular processes → Homeostasis → Acquisition of iron → ABC transporters for the uptake of iron/ siderophores
• Metabolism → Additional metabolic pathways → Iron metabolism → ABC transporters for the uptake of iron/ siderophores
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,379,112 3,379,939

The protein

Catalyzed reaction/ biological activity

• ATPase for the FeuA-FeuB-FeuC siderophore ABC transporter and for the YfhA-YfiY-YfiZ siderophore ABC transporter

Protein family

• ABC transporter family (according to Swiss-Prot)

Paralogous protein(s)

• FhuC, FecF, FpbP

Structure

• 4R9U, the E. coli BtuC-BtuD complex, BtuD shares 32% identity, 57% similarity with YusV, PubMed

Localization

• associated to the membrane (via FeuB-FeuC and YfhA-YfiZ) PubMed

Expression and Regulation

Operons

• Genes: yusV-yusU
  Description: PubMed

  Regulatory mechanism

  • Fur: repression, PubMed, in Fur regulon

Biological materials

Mutant

• MGNA-B599 (yusV::erm), available at the NBRP B. subtilis, Japan
• BKE32940 (yusV::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAACCGCTCCTTTTTGCT, downstream forward: _UP4_TAAATAACGCAGCGAAGGAG
• BKK32940 (yusV::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAACCGCTCCTTTTTGCT, downstream forward: _UP4_TAAATAACGCAGCGAAGGAG

References

Loading